algorithms r statistical computing software gnu general public license (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms r statistical computing software gnu general public license
Algorithms R Statistical Computing Software Gnu General Public License, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44064 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+r+statistical+computing+software+gnu+general+public+license/Imaris/pm31003939-202-220-236
Average 99 stars, based on 44064 article reviews
Algorithms R Statistical Computing Software Gnu General Public License, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44064 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+r+statistical+computing+software+gnu+general+public+license/Imaris/pm31003939-202-220-236
Average 99 stars, based on 44064 article reviews
algorithms r statistical computing software gnu general public license - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Recombinant:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Modification:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Enzyme-linked Immunosorbent Assay:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Reverse Transcription:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji SYBR Green Assay:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Synthesized:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Plasmid Preparation:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Expressing:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji shRNA:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Sequencing:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Software:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji Imaging:Article Title: Plasmacytoid Dendritic Cells and Infected Cells Form an Interferogenic Synapse Required for Antiviral Responses. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Latrunculin B (Lat B) Sigma-Aldrich Cat# L5288, CAS:76343-94-7 Arp2/3 complex inhibitor I (CK-666) Merck Millipore Cat# 182515, CAS:442633-00-3 CDC42 inhibitor (ML141) Sigma-Aldrich Cat# SML0407, CAS:71203-35-5 Chlorpromazine Sigma-Aldrich Cat# C8138, CAS:69-09-0 Dynasore Sigma-Aldrich Cat# D7693, CAS:1202867-00-2 Imiquimod Invivogen Cat# tlrl-imqs, CAS:99011-78-6 Vybrant cell-labeling solution (CM-DiI) Life Technologies Cat# V22888, CAS:180854-97-1 CellTrace Violet cell Proliferation kit (CTV) Life Technologies Cat# C34557 poly-L-lysin (P6282) Sigma-Aldrich Cat# P6282, CAS:25988-63-0 Dulbecco’s modified Eagle medium (DMEM) Life Technologies Cat# 10566016 Penicillin-Streptomycin Life Technologies Cat# 15140122 L-Glutamine Life Technologies Cat# A2916801 MEM Non-Essential Amino Acids Solution Life Technologies Cat# 11140050 Critical Commercial Assays VeriKine Human Interferon Alpha Multi-Subtype ELISA Kit PBL Interferon Source Cat# 41105-2 DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA PBL Interferon Source Cat# 61830-1 VeriKine Human Interferon Beta ELISA Kit PBL Interferon Source Cat# 41410-1 High-Capacity cDNA Reverse Transcription Kit Life Technologies Cat#4368813 PowerUp SYBR Green Master Mix Life Technologies Cat# A25742 BDCA-4-magnetic beads Miltenyi Cat# 130-090-532 Experimental Models: Cell Lines Human hepatoma cell line Nakabayashi et al., 1982 Huh-7.5.1 (RRID:CVCL_E049) Huh-7.5.1c2 cells that harbor the JFH-1 subgenomic replicon Kato et al., 2003 N/A Oligonucleotides IRS661 (5’-TGCTTGCAAGCTTGCAAGCA-3’) synthesized on a phosphorothioate backbone (Decembre et al., 2014) N/A Recombinant DNA lentivirus-based vector expressing shRNA against ICAM-1 (TRCN0000372477, target sequence: GCCCGAGCTCAAGTGTCTAA) Sigma-Aldrich Cat# SHCLNV-NM_000201 Softwares and Algorithms R Statistical Computing Software GNU General Public License https://www.r-project.org/ Image J software (Fiji) NIH http://imagej.net/Fiji |